Jim, one of two equal partners of the JJ Partnership, a general partnership, contributed business property with an adjusted basis to him of $15,000 and a fair market value of $10,000 to the JJ Partnership. Jim’s capital account was credited…
Mention and explain the basics of physical security. Include a discussion on the types of locking systems that could be employed and a description of outer and inner perimeter controls and the roles of protective lighting devices in your response.
Is postwar Japan better understood in terms of a return to the liberalism of the year 1920s, or as a fresh start based on Occupation reforms? Explain why did the Occupation of Japan go so smoothly and how does that…
Hatch company produces a product that passes through three processes: Fabrication, Assembly, and Finishing. All manufacturing costs are added uniformly for all processes. The following information was obtained for Fabrication Department for December: a. Direct Materials $72,720Direct Labor $108,000Overhead $36,000…
Carlise Corp., which manufactures ceiling fans, currently has two product lines, the Indoor and the Outdoor. Carlise has total overhead of $141,872. Carlise has identified the following information about its overhead activity cost pools and the two product lines: Activity…
By using the DNA sequence 3′ ACTACGGCAATACGGGCTGGATCTGG 5′, answer the given questions. a) Write down the mRNA sequence. b) Write down the sequence of the start codon. c) Write down the sequence of the stop codon.
a) Explain how the mitochondrion evolved as an organelle according to the endosymbiont hypothesis. b) Stephen Jay Gould (“What Is a Species?” Discover, December 1992.) Wrote, “We have become, by the power of a glorious evolutionary accident termed intelligence, the…
Decreasing our energy consumption is vital in our quest to preserve the environment. The conversion from fossil fuels to renewable energy sources will not occur overnight. In the meantime, individuals and businesses can reduce their dependence on fossil fuels by…
a) In risk, what are the main differences between the toxicity quotient approach and the hazardous quotient approach? b) Explain why can sediments become significant in the risk assessment? c) What processes might retard chemical movement in the atmosphere?
Brian Bradley, a calendar year taxpayer, purchased 1,000 shares of Newton Corp. On October 23,2011, for $15,000. He sold these shares on January,20,2012, for $7,000. On each of the four days from January 24 through January 27, 2012, Brian purchased…
